.png)
HATRI news
12 November 2021
INFORMATION FROM NCBI :
HAS BEEN ACCEPTED WITH CODE MT:MN519731.1
The DNA barcode of Baccaurea ramiflorafrom Phong Dien, Can Tho city, Vietnam based on gene rbcL on locus: MT894358.1
Nguyen thi Lang and Bui Chi Hieu
Abstract
The DNA barcode ofBaccaurea ramiflora cultivar from based on matK gene.in Phong Dien, there is a MATK area that is assessed on the code chain. Study dna sequences applied to regional barcodes for Lang, sequencing code with matK gene region. The combed locus is MN519731.1 which has 474 bp .In the NCBI system and proposes reliable DNA barcodes to identify this plant variety. In this article, an M 2 Baccaurea ramiflora tree at Bay Ngu Garden House (Phong Dien) is analyzed. Polymerase chain reactions used dna to amplify rbcL gene fragments with bait contain Lang F2R2 dau (2007) (5'tttccttaattgccgtgtcc 3') and reverse bait (5' ccgaaccaaaacgaactctc 3').The software BLAST, Bioedit, and ClustalX were used to analyze the data. Barcode DNA of Baccaurea ramiflora showed 422 bp nucleotides sequence based on rbcLgene. An indication of six Baccaurea ramiflora cultivars showed that high similarity 99% with Pandanus conoideus Lam. It can be concluded that rbcLgene can be used to determine the species level in Phyllanthaceae. Locus: MT894358.1
Key words: Baccaurea ramiflora;BLAST, Bioedit, gen rbcL
