HATRI news
7 May 2021
INFORMATION FROM AG 4 LANDRACES NCBI :
HAS BEEN ACCEPTED WITH CODE MT: 177967
(Oryza sativa isolate AG4 peroxidase (aroma) pseudogene, partial sequence) due to Prof. Nguyen Thi Lang (HATRI) has successfully deciphered DNA and accepted the registration of AG4 rice.
Rice (Oryza sativa L.) is the staple food of more than three billion people, over half the world’s population. It provides 27% of dietary energy and 20% of dietary protein in the developing world. Traditional varieties, sometimes called landraces or local or farmer varieties, form the foundation on which to build better rice plants. Landraces are generally considered to be a rich source of genetic variation. Furthermore, local varieties provide farmers with alternatives in areas where modern rice varieties are not well adapted and contribute to diversity at the field level. However, the number of traditional varieties being planted has reduced, with a few productive and relatively uniform high-yielding varieties dominating the rice landscape.Landrace rice on Tri Ton and Tinh Bien from An Giang province, Vietnam has grown for a long time, over many years of cultivation, these varieties gradually degenerate and the gene source is also eroded. In 2019-2021, the topic: SELECTION OF SOME RICE VARIETIES IN THE FIELD OF GOOD QUALITY IN THE DISTRICT OF DEFENSE AND SAFETY, AN GIANG PROVINCE is head by Prof. Nguyen Thi Lang.
.jpg)
Figure 1: AG 4 growing at Tinh Bien, An Giang, VietNam (photo by Lang Nguyen)
Overview objectives: Collecting, evaluatig and selecting a number of rice varieties in the above crop with good quality and suitable characteristics for ecological conditions in Tinh Bien and Tri Ton districts, An Giang province.- Specific objectives: Selecting 02 rice lines of the above crop with the same or better quality than Nang Nhen rice.
From the original 225 individuals AG 4 collected. In the first serving, conducting a productivity assessment, the yield composition of 100 individuals of AG 4, selecting the 10 best individuals of each variety in the second, and through the third case continues to evaluate and select 1 elite line AG4. Similarly evaluated by the PCR-SSR method genotype only selects 11 elite AG 4 lines. By evaluatiy the fragrance selected 4 ag4 lines to express the fragrance through quantique. Combining genotypes and styling when evaluati captioned overall shows that for the AG 4 variety, line 7 also proved to be the most outstanding line with aroma-like properties. Therefore, the line /number 7 of AG 4 is selected to decode dna sequences. Please seedetaile: MT:177967
ORIGIN DNA AG 4
1 cccaatggtgcagatatttgggtggcgtttctgaagggttaaatagtaaaaacaaaatat
61 tcaattaataaataaaactaaggaaagaagaaaagagcgagagggaaaaaagggggaaaa
121 aataaaaaaaaaaagccaaaaaacgcgcgtgtggttgtttaaaacacaacactttgttta
181 accccacattagccccgggacccccaccatataattgttattataatttgatttcccaaa
241 gagatatttaaagttaattttaacaaagtttttaagtattatttaatgtgtctggtctgg
301 gttccttgtcagtactcgggtggggcaatgtctgagtctgctttacatgcccctgtctcc
361 attacccctcaggaaaatgttcttttttcatgtaaatatactaagcaataatcttgaaaa
421 tattcacaggagaaaaacaaaaatgatctagcataaacagagacagagagtcgtataata
481 cacttactgctgtatttaatttttttcaaatatagcctgcattgttaaattagggaaaaa
541 aaaagaaactacctttgaaccctagcaagcacattctgaattatttccacaaaccaaaac
601 agaaatctgccgcatttcacgtgtaaaagaagaaacaaaaccgagatttttaatcaagag
661 cgagcatgacagcatgacacaggccctcttaaaccgatggtgtatcgaaagtaaatttaa
721 atttaaacaggatggcaaacacaccccatatcctagtacaaatacgggtggatgcagcgg
781 atccacctggactatccaaattggctgtcggggccagatcacgctgtgcgctgggcccca
841 ccgccatttcaccacgcaccaaacacgacccactaaaaatcccgccacgtgtgcccaccc
901 cggtgggacccacctccctcccgctttatatacggaccatcacgaacgcatccgaaaatt
961 aactacgaaaagagagagagagagaagagagttttttagcgagctcgcgcgaatgcgaag
1021 ccaag
//











