HOME >> NEWS » INTERNAL NEWS
Analysis of Quality of Landrace Rice: AG 3variety in An Giang, Vietnam
02/09/2021 INTERNAL NEWS 338
 
 
HATRI news
17  Junes 2021
This had published This had published their work on Journal of Agriculture and Rural Development.  No 410:11:3-9.  2021
Analysis of Quality of Landrace Rice: AG 3variety in An Giang, Vietnam
Nguyen Thi Lang, Le Hoang Phuong, Bui Chi Hieu,  
Nguyen Trong Phuoc, Bui Chi Buu
High Agricultural Technology Research Institute for Mekong delta
 
Abstract
  Landrace rice genotypes AG 3 were evaluated in Tri Ton, Tinh Bien, An Giang Province with three replications in a field experiment during 2019-2020. The analysis revealed significant differences among the genotypes against all the characters studied. In general, phenotypic variance was higher than the corresponding genotypic variance for all the characters studied. AG 3 rice is considered a unique landrace varietal group because of its aroma and superior grain quality.To confirm the presence or absence of fragrance in AG 3. A set of 8 lines was phenotyped using gas chromatographic separation to quantify 2AP content in milled rice samples. KOH tested and PCR method with two directives RM223 and FMU1-2 recorded to select   some lines with the best fragrance followed by line 100, 80 and line 91.  The shape is determined by the length: width ratio.- through shape evaluation, the length and width of AG 3 are highly. As well as a good level 0 chalkiness. The line that reaches 100% is line 100, 32, 14 and line 80. - Rice quality analysis recorded amylose content recorded most of the low content on AG3 lines. This proves the delicious lines of rice.  - Milling quality determines the final yield and fracture rate of milled rice. Recorded line 100 for high milling rate over 50%.  -The protein content of rice varieties ranges from 7.2 to 8.7%. Lines 100 and 8 have the highest protein content (8.7-8.6%). Characters like number of panicles per plant, panicle weightg), number of grains per panicle and grain yield recorded high. The grain yield analysis revealed significant differences among lines.  Selected AG 3 lines 100) can be put into use in the breed selection program in the near future to help the locality. With DNA sequencing:
       1 aatctgtgcagtgagccggggtcgccgccgtgccatctcctcgtcgccacgcttcttttc
       61 cgtctccgcgaaatttaaagttgtcgccggctaagagaggaggggcccggcgccgctcca
      121 gatccacgtcgccaccgccgtcctcctcgctccgtctcctcgtcgctgccgagagaggag
      181 gggcctgattctgctccagatccgtgcacccgccgccgtcctcctcgctccgcctcctcg
      241 tcgccggccgagagaggaagggcccggcgccactccaggcccccgctgtcctcctcgctc
      301 cgtctcctcatcgccggcgctgtgtgtgctaccaccaccactgcgcgcaaggcgctgtcg
      361 ttcaccccaccgttctactatgcgcatggcgtcatgtagactggagtccgccgtgtggcc
      421 gtggtcgccgaaccggcgccaagaaaggggaaagtgggagagagaatgggaaagtaacag
      481 agagaatgggttgggatggttggtttggggatcgtagtaacctgcagtgtgagaggtatg
      541 gattcgttgtgcatctatcttaaaggtaattcaaataaaggacttgcactgctactgcct
      601 aaagcacagtgccttagagttgcttccgggaagggaaacagtgccttagagttactcaca
      661 cagtgcgacgaattctctcgacgttggcaagcagcgcgagcttggatatgttgacgtctg
      721 caaaaattttaattaaaaaaacgttggcaatgtgtgagaacttggatatgatgggcccat
      781 cgcgaaaaatagtggaaaatacttaaaagggttgtgaaggcgtaaaggggaatagattga
      841 gtggggaaagaagtggagaaaaggggggggaaagggggaaaaag
 
Keywords: aroma, amylose, Chalkiness,  Genotypic, phenotypic,  milling quality 
  
 
 
   
 
Figure 1. Ag 3 rice grain size compared to KDM 105, Jasmine 85, AG 24
 
 

 

Figure 4. Photograp of field growing AG 3 lanracevarieyat Tinh Bien,
An Giang, VietNam
 
 
 
Video Clip
Visitors counter
số người truy cậpsố người truy cậpsố người truy cậpsố người truy cậpsố người truy cậpsố người truy cậpsố người truy cập
số người truy cậpToday:128
số người truy cậpYesterday:340
số người truy cậpThis week:1178
số người truy cậpThis month:35654
số người truy cậpAll:123508
số người truy cậpOnline:14