Trang Chủ >> TIN TỨC » TIN CỦA VIỆN
THÔNG TIN TỪ NGÂN HÀNG GEN QUỐC TẾ GIỐNG LÚA MÙA AG 4 ĐÃ ĐƯỢC CHẤP NHẬN VỚI MÃ MT:177967 (Oryza sativa isolate AG4 peroxidase (aroma) pseudogene, partial sequence)
08/05/2021 TIN CỦA VIỆN 99
 
 
THÔNG TIN TỪ NGÂN HÀNG GEN QUỐC TẾ GIỐNG LÚA MÙA AG 4 ĐÃ ĐƯỢC CHẤP NHẬN VỚI MÃ MT:177967
(Oryza sativa isolate AG4 peroxidase (aroma) pseudogene, partial sequence)
 
      Do GS. TS Nguyễn thị Lang: Viện Nghiên Cứu Nông Nghiệp Công Nghệ Cao ĐBSCL đã giải mã DNA thành công và chấp nhận. Đăng ký ngân hàng gen chuỗi mã Lúa mùa AG4.
 
        Lúa mùa An Giang:
 
      Giống lúa mùa ruộng trên được bà con nông dân vùng Tri Tôn và tịnh Biên tỉnh An Giang, Việt Nam trồng rất lâu đời, qua nhiều năm canh tác, các giống này dần thoái hóa và nguồn gen cũng bị xói mòn. Trong hai năm 2019-2021, đề tài: CHỌN LỌC MỘT SỐ GIỐNG LÚA MÙA RUỘNG TRÊN CÓ CHẤT LƯỢNG TỐT TẠI HUYỆNTỊNH BIỆN VÀ TRI TÔN, TỈNH AN GIANG do GS. TS Nguyễn thị Lang chủ trì. Mục tiêu tổng quan: Sưu tập, đánh giá và chọn lọc một số giống lúa mùa ruộng trên có chất lượng tốt và có đặc tính phù hợp điều kiện sinh thái tại huyện Tịnh Biên và Tri Tôn, Tỉnh An Giang.
  • Mục tiêu cụ thể: Chọn lọc được 02 dòng lúa mùa ruộng trên đặc sắc với chất lượng tương đương hoặc tốt hơn lúa Nàng Nhen (đạt chỉ dẫn địa lý), chất lượng gạo đạt yêu cầu xuất khẩu.
Hình giống lúa AG 4 trồng ngoài đồng ruộng tại Tịnh Biên, An Giang (Ảnh bởi Lang Nguyễn)
Từ 225cá thể ban đầu AG 4 thu thập. Trong vụ phục tráng thứ nhất, tiến hành đánh giá năng suất, thành phần năng suất của 100cá thể cá thểAG 4, chọn ra 10cá thể tốt nhất của từng giống trong thứ hai, và qua vụ thứ ba tiếp tục đánh giá và chọn lọc 1dòng ưu tú AG4. Tương tự đánh giá bằng kiểu gen  phương pháp PCR-SSR chỉ tuyển chọn 11 dòng ưu túAG 4. Qua đánh giá mùi thơm chọn được 4 dòng AG4thể hiệnmùi thơm qua định lượng.Kết hợp kiểu gen và kiểu hìnhkhi đánh giá tổng thể cho thấy: đối với giốngAG 4, dòng 7cũng tỏ ra là dòng nổi trội nhất với các đặc tính tương mùi thơm. Vì vậy, dòng/số 7 của AG 4  được chọn lọc để giải mã trình tự DNA.
Xin Truy cập mã DNA của AG 4 là MT:177967
ORIGIN DNA của AG 4
        1 cccaatggtgcagatatttgggtggcgtttctgaagggttaaatagtaaaaacaaaatat
       61 tcaattaataaataaaactaaggaaagaagaaaagagcgagagggaaaaaagggggaaaa
      121 aataaaaaaaaaaagccaaaaaacgcgcgtgtggttgtttaaaacacaacactttgttta
      181 accccacattagccccgggacccccaccatataattgttattataatttgatttcccaaa
      241 gagatatttaaagttaattttaacaaagtttttaagtattatttaatgtgtctggtctgg
      301 gttccttgtcagtactcgggtggggcaatgtctgagtctgctttacatgcccctgtctcc
      361 attacccctcaggaaaatgttcttttttcatgtaaatatactaagcaataatcttgaaaa
      421 tattcacaggagaaaaacaaaaatgatctagcataaacagagacagagagtcgtataata
      481 cacttactgctgtatttaatttttttcaaatatagcctgcattgttaaattagggaaaaa
      541 aaaagaaactacctttgaaccctagcaagcacattctgaattatttccacaaaccaaaac
      601 agaaatctgccgcatttcacgtgtaaaagaagaaacaaaaccgagatttttaatcaagag
      661 cgagcatgacagcatgacacaggccctcttaaaccgatggtgtatcgaaagtaaatttaa
      721 atttaaacaggatggcaaacacaccccatatcctagtacaaatacgggtggatgcagcgg
      781 atccacctggactatccaaattggctgtcggggccagatcacgctgtgcgctgggcccca
      841 ccgccatttcaccacgcaccaaacacgacccactaaaaatcccgccacgtgtgcccaccc
      901 cggtgggacccacctccctcccgctttatatacggaccatcacgaacgcatccgaaaatt
      961 aactacgaaaagagagagagagagaagagagttttttagcgagctcgcgcgaatgcgaag
     1021 ccaag
//
Video Clip
Thống kê lượt truy cập
số người truy cậpsố người truy cậpsố người truy cậpsố người truy cậpsố người truy cậpsố người truy cậpsố người truy cập
số người truy cậpHôm nay:309
số người truy cậpHôm qua:436
số người truy cậpTuần này:1175
số người truy cậpTháng này:1634
số người truy cậpTất cả:575436
số người truy cậpĐang trực tuyến:18